Details of Primer Pair 'ABC17073_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17073_L01R01473Nils Rostoks2004-01-26 ABC17073_L01 AGTTGGCGAGCCTCCTGATG 244 20 Nils Rostoks 2004-01-26 Illumina
ABC17073_R01 TGCTGAGTTCATCCCCACCA 716 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17073_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes