Details of Primer Pair 'ABC17088_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17088_L01R01410Nils Rostoks2004-01-26 ABC17088_L01 TGGGAAGTTCTCGTCCAGGC 593 20 Nils Rostoks 2004-01-26 Illumina
ABC17088_R01 GGACGGTGAATGAAGCAGCC 1002 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17088_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes