Details of Primer Pair 'ABC17091_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17091_L01R01435Nils Rostoks2004-01-26 ABC17091_L01 AGGCGCAGGTGAGGATCAAG 199 20 Nils Rostoks 2004-01-26 Illumina
ABC17091_R01 TTGCTCTGCCTGCTGTGTCA 633 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17091_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes