Details of Primer Pair 'ABC17236_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17236_L01R01499Nils Rostoks2004-01-26 ABC17236_L01 CGTGCCATTGCTGGAATCAG 73 20 Nils Rostoks 2004-01-26 Illumina
ABC17236_R01 CAAACGACTACGGTCATCGCC 571 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17236_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes