Details of Primer Pair 'ABC17320_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17320_L01R01524Nils Rostoks2004-01-26 ABC17320_L01 CGCCAGACGCTCCTCTCATT 121 20 Nils Rostoks 2004-01-26 Illumina
ABC17320_R01 TGGAAGCGATGCAACAAGGA 644 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17320_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes