Details of Primer Pair 'ABC17471_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17471_L01R01578Nils Rostoks2004-01-26 ABC17471_L01 GTAGCTCGAGCGAGCCCAAA 820 20 Nils Rostoks 2004-01-26 Illumina
ABC17471_R01 CACGGTGCATCAAACGAGGA 1397 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17471_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes