Details of Primer Pair 'ABC17647_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17647_L01R01421Nils Rostoks2004-01-26 ABC17647_L01 CTGTTCTGGGCCTTCTGCGT 363 20 Nils Rostoks 2004-01-26 Illumina
ABC17647_R01 AGAATCGAGCCAGCGATTGG 783 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17647_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes