Details of Primer Pair 'ABC17649_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17649_L01R01599Nils Rostoks2004-01-26 ABC17649_L01 CCCAAGGACAAGCCAAAGGA 271 20 Nils Rostoks 2004-01-26 Illumina
ABC17649_R01 AAGCCCTGGGGTTCACTGCT 869 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17649_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes