Details of Primer Pair 'ABC17685_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17685_L01R01451Nils Rostoks2004-01-26 ABC17685_L01 TGTTCCTGCTCTCGTGCCAG 454 20 Nils Rostoks 2004-01-26 Illumina
ABC17685_R01 GCAGCTCAAACACCGAGCAA 904 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17685_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes