Details of Primer Pair 'ABC17741_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC17741_L01R01436Nils Rostoks2004-01-26 ABC17741_L01 CTGCTTCCATGTCCGTCGTG 670 20 Nils Rostoks 2004-01-26 Illumina
ABC17741_R01 CAAGCTGCGACCTCCGATTT 1105 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC17741_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes