Details of Primer Pair 'ABC18005_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18005_L01R01176Nils Rostoks2005-03-17 ABC18005_L01 TCCTCACACAGAGAGAAGTGC 16 21 Nils Rostoks 2005-03-17 Invitrogen
ABC18005_R01 CCCACACGGTGTAGTAGAGG 192 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC18005_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB