Details of Primer Pair 'ABC18109_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18109_L01R01503Nils Rostoks2004-01-26 ABC18109_L01 GAAGCTGCAAAGCCTCTCGG 124 20 Nils Rostoks 2004-01-26 Illumina
ABC18109_R01 ATACGGCTTGCGAAAACCCA 626 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18109_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes