Details of Primer Pair 'ABC18140_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18140_L01R01432Nils Rostoks2004-01-26 ABC18140_L01 AAGCAGCCTGCGGTTGTAGC 628 20 Nils Rostoks 2004-01-26 Illumina
ABC18140_R01 AACTCCCTCAGCTGGCATCG 1059 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18140_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes