Details of Primer Pair 'ABC18178_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18178_L01R01453Nils Rostoks2004-01-26 ABC18178_L01 GGTGTGCAACGAGTGGAACG 259 20 Nils Rostoks 2004-01-26 Illumina
ABC18178_R01 CCGCAAGCCTGCTACCTGTT 711 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18178_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes