Details of Primer Pair 'ABC18274_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18274_L01R01480Nils Rostoks2004-01-26 ABC18274_L01 GGATGTTCCGAGCAAATGGC 516 20 Nils Rostoks 2004-01-26 Illumina
ABC18274_R01 ACCGCATGAGGAGCTTGACC 995 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18274_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes