Details of Primer Pair 'ABC18641_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18641_L01R01493Nils Rostoks2004-01-26 ABC18641_L01 CCAACCTCACCGCCAACTTC 373 20 Nils Rostoks 2004-01-26 Illumina
ABC18641_R01 TTTGATCGCCCGGGATTCTA 865 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18641_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes