Details of Primer Pair 'ABC18717_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18717_L01R01404Nils Rostoks2004-01-26 ABC18717_L01 CCTTCATGGTGCGACCGAAT 512 20 Nils Rostoks 2004-01-26 Illumina
ABC18717_R01 TCAACCCAACCCCAGCTGAT 915 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18717_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes