Details of Primer Pair 'ABC18746_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC18746_L01R01512Nils Rostoks2004-01-26 ABC18746_L01 CGGTGGAACTGGTGATGCAG 428 20 Nils Rostoks 2004-01-26 Illumina
ABC18746_R01 TGCGTGGAAACAAAGTCCGA 939 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC18746_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes