Details of Primer Pair 'ABC19175_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC19175_L01R01432Nils Rostoks2004-01-26 ABC19175_L01 TATTGGCCTGGTGGGGAGAA 3147 20 Nils Rostoks 2004-01-26 Illumina
ABC19175_R01 TCGGACTGTGCATCGAGAGC 3578 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC19175_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes