Details of Primer Pair 'ABC19616_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC19616_L01R01429Nils Rostoks2004-01-26 ABC19616_L01 AGGCCATCGTCGACACCTTC 501 20 Nils Rostoks 2004-01-26 Illumina
ABC19616_R01 ATGCGGTGATCCTCCAGCTC 929 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC19616_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes