Details of Primer Pair 'ABC19747_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC19747_L01R01412Nils Rostoks2004-01-26 ABC19747_L01 GGCTGATGAGGTACGACCCG 343 20 Nils Rostoks 2004-01-26 Illumina
ABC19747_R01 GACCCGTTACGCTCCACCAC 754 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC19747_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes