Details of Primer Pair 'ABC20253_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC20253_L01R01423Nils Rostoks2004-01-26 ABC20253_L01 GCGACGTTCCTCCTCGTTGT 391 20 Nils Rostoks 2004-01-26 Illumina
ABC20253_R01 GCAGGCATGCTAGTTGGGCT 813 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC20253_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes