Details of Primer Pair 'ABC20402_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC20402_L01R01578Nils Rostoks2004-01-26 ABC20402_L01 ATGGGACAGGCCAGGGATTT 702 20 Nils Rostoks 2004-01-26 Illumina
ABC20402_R01 CACGCAAGCACCTGAATTGG 1279 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC20402_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes