Details of Primer Pair 'ABC20569_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC20569_L01R01188Nils Rostoks2005-03-17 ABC20569_L01 ATCGAGCACCTACGAACC 690 18 Nils Rostoks 2005-03-17 Invitrogen
ABC20569_R01 TTGCATAGCGGAAGTAATCC 502 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC20569_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB