Details of Primer Pair 'ABC20733_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC20733_L01R01590Nils Rostoks2004-01-26 ABC20733_L01 CAGCAGTATCCTCCTGGCCG 99 20 Nils Rostoks 2004-01-26 Illumina
ABC20733_R01 CCAAATCTCCTCGCCAATGC 688 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC20733_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes