Details of Primer Pair 'ABC20989_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC20989_L01R01415Nils Rostoks2004-01-26 ABC20989_L01 GGGATGCAGGTTTCTTCCGA 615 20 Nils Rostoks 2004-01-26 Illumina
ABC20989_R01 GACATCGTTCCCCATCAGCC 1029 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC20989_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes