Details of Primer Pair 'ABC21640_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC21640_L01R01402Nils Rostoks2004-01-26 ABC21640_L01 CCCACTGACCCCTACGAACG 389 20 Nils Rostoks 2004-01-26 Illumina
ABC21640_R01 CCGCTTCGTCTTGGCAAACT 790 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC21640_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes