Details of Primer Pair 'ABC22290_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC22290_L01R01176Nils Rostoks and Joanne Russel2005-03-17 ABC22290_L01 AAACCTGACACCATCAGCAA 561 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen
ABC22290_R01 AGCTGGAGCTTGAAATGGAG 385 20 Nils Rostoks and Joanne Russel 2005-03-17 Invitrogen

Comment History of 'ABC22290_L01R01'

No comments recorded for ABC22290_L01R01.