Details of Primer Pair 'ABC22343_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC22343_L01R01586Nils Rostoks2004-01-26 ABC22343_L01 CCGGAGCAAGCTGATGAACC 203 20 Nils Rostoks 2004-01-26 Illumina
ABC22343_R01 TGACAGGGCAGCGCTTGATA 788 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC22343_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes