Details of Primer Pair 'ABC23255_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC23255_L01R01182Nils Rostoks2005-03-17 ABC23255_L01 CTCAGTGCCAGCACATTTTC 695 20 Nils Rostoks 2005-03-17 Invitrogen
ABC23255_R01 CTGGCAAAAGGAGGAAAGAA 877 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC23255_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB