Details of Primer Pair 'ABC24102_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC24102_L01R01472Nils Rostoks2004-01-26 ABC24102_L01 AACTTCGTGACGGGGAGCAC 170 20 Nils Rostoks 2004-01-26 Illumina
ABC24102_R01 GGGCATCCTACAGGTCCACG 641 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC24102_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes