Details of Primer Pair 'ABC24906_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC24906_L01R01453Nils Rostoks2004-01-26 ABC24906_L01 CGCGATGAAAGATCAAGGGG 588 20 Nils Rostoks 2004-01-26 Illumina
ABC24906_R01 CTGTGCCCAGCCGTCTTCTT 1040 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC24906_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes