Details of Primer Pair 'ABC25019_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC25019_L01R01402Nils Rostoks2004-01-26 ABC25019_L01 TGGCATGTTGTGATGAAACGC 2021 21 Nils Rostoks 2004-01-26 Illumina
ABC25019_R01 TTCAAGTGGAGGGCCACACA 2422 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC25019_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes