Details of Primer Pair 'ABC25477_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC25477_L01R01400Nils Rostoks2004-01-26 ABC25477_L01 TCTTTGAGCCCACCGAGACC 109 20 Nils Rostoks 2004-01-26 Illumina
ABC25477_R01 CTCTGGCCTTCCAGCACCTG 508 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC25477_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes