Details of Primer Pair 'ABC25538_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC25538_L01R01194Nils Rostoks2005-03-17 ABC25538_L01 CCTCCCACTATCTCTTCTCTCC 8 22 Nils Rostoks 2005-03-17 Invitrogen
ABC25538_R01 GAGTGTTACTGCCGATTTGC 202 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC25538_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB