Details of Primer Pair 'ABC25691_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC25691_L01R01219Nils Rostoks2005-03-17 ABC25691_L01 ACGAGCTGATATCCCACGAG 6 20 Nils Rostoks 2005-03-17 Invitrogen
ABC25691_R01 TCCGAGCTTCTTATCTTTGG 225 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC25691_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB