Details of Primer Pair 'ABC26393_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC26393_L01R01434Nils Rostoks2004-01-26 ABC26393_L01 CGACTTCCACCACGACAACG 454 20 Nils Rostoks 2004-01-26 Illumina
ABC26393_R01 GGCCTCGAATCGGAGCAGTA 887 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC26393_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes