Details of Primer Pair 'ABC40618_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC40618_L01R01350Nils Rostoks2004-05-27 ABC40618_L01 CACCACCCCTCCATCGAACT 26 20 Nils Rostoks 2004-05-27 Qiagen
ABC40618_R01 CGCTTGACGGGTCGAAAATC 376 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC40618_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined