Details of Primer Pair 'ABC44574_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC44574_L01R010Nils Rostoks2004-05-27 ABC44574_L01 CCTTCGCCAACGAGAAGGTG 6 20 Nils Rostoks 2004-05-27 Qiagen
ABC44574_R01 AGCGAATACGGGGTGGCATT 0 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC44574_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined