Details of Primer Pair 'ABC46137_L03R03'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC46137_L03R03176Nils Rostoks2003-09-30 ABC46137_L03 ATCGGCACCTCGTGCTCTTC 34 20 Nils Rostoks 2003-09-30 Invitrogen
ABC46137_R03 GCACCAGCAGATGGAACAGG 210 20 Nils Rostoks 2003-09-30 Invitrogen

Details of Primer Pair 'ABC46137_L04R04'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC46137_L04R041000Nils Rostoks2003-09-30 ABC46137_L04 GCACCAGCCTCCTTTCC 95 17 Nils Rostoks 2003-09-30 Qiagen
ABC46137_R04 GTCTTTGAATGTTGAATCCTCC 228 22 Nils Rostoks 2003-09-30 Qiagen

Comment History of 'ABC46137_L03R03'

DateSubmitterComment
2003-09-30 Nils Rostoks Single, ca. 1.5 kb fragment on gel. Sequences very dirty.

Comment History of 'ABC46137_L04R04'

DateSubmitterComment
2003-09-30 Nils Rostoks Can try different combinations: F03_R04 F04_R03 F03_R03 and re-amplify with either F04 or R04