Details of Primer Pair 'ABC47832_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC47832_L01R01300Nils Rostoks2004-05-27 ABC47832_L01 CCTGATCCTGCTGGTGGTGT 3 20 Nils Rostoks 2004-05-27 Qiagen
ABC47832_R01 CTTGAGGCCGAGGTTGTGCT 303 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC47832_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined