Details of Primer Pair 'ABC50108_L04R04'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC50108_L04R04284Nils Rostoks2004-05-27 ABC50108_L04 GGGGTCGAGTGTGGATACGC 95 20 Nils Rostoks 2004-05-27 Qiagen
ABC50108_R04 GGGTGTACCCGTTCGAGGTG 379 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC50108_L04R04'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined