Polymorphisms for ABC00388

Schematic of mutation locations within contig assembly 'ABC00388_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 6
1
6
2
8
3
1
1
3
1
3
8
2
2
5
2
7
6
3
4
9
3
6
9
3
7
3
4
0
5
4
2
1
4
5
7
4
8
4
5
2
3
5
7
3
6
9
2
7
2
2
7
2
8
7
6
8
Golden Promise |L01R01| R|a_1AATACCGGA*ATTCTTCACG
Golden Promise |L01R01| L|a_1AATACCGGA*ATTCTTCACG
HS92 |L01R01| R|a_1AACACTGGAAGCCTCCGTTA
HS92 |L01R01| L|a_1AACACTGGAAGCCTCCGTTA
Lina |L01R01| R|a_1attcccacAAGTCCaCGTTA
Lina |L01R01| L|a_1..TACCGGAAatTcTCgttc
Morex |L01R01| L|a_1GATACCGAAAATTCTCGTTA
Morex |L01R01| R|a_1AATACCGAAAATTCTCGttA
OWB D |L01R01| L|a_1AATATCAGAAACCCCCCTCG
OWB D |L01R01| R|a_1A*TATCAGAAACCCCCCTCG
Optic |L01R01| L|a_1AATGCCGGAAGCCTCCGTTA
Optic |L01R01| R|a_1AATGCCGGAAGCCTCCGTTA
OWB R |L01R01| L|a_1AATACCGGA*ATTCTTCACG
OWB R |L01R01| R|a_1aatccCGG**AtTCtTcacg
Steptoe |L01R01| R|a_1AATGcCGGAAGCCTCCGTtA
Steptoe |L01R01| L|a_1AATGCCGGAAGCCTCCGTTA