Polymorphisms for ABC00912

Schematic of mutation locations within contig assembly 'ABC00912_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 8
7
8
8
9
1
9
3
9
6
9
8
9
9
1
0
0
1
1
3
1
1
7
1
4
8
1
9
3
2
3
5
2
4
1
2
4
7
2
5
9
2
7
4
2
8
9
2
9
2
3
3
5
3
7
8
3
9
1
4
1
2
4
1
4
4
1
7
4
2
0
4
2
1
4
3
0
4
3
4
4
4
8
4
4
9
4
5
4
4
5
5
4
5
8
4
5
9
4
7
0
4
7
4
4
8
3
4
8
9
5
0
9
5
1
0
5
2
6
5
2
9
5
3
1
5
3
7
5
4
8
5
4
9
5
5
4
5
5
5
5
6
3
5
6
8
5
7
8
5
8
9
5
9
0
6
0
1
6
1
0
6
3
5
6
3
8
6
5
2
6
7
8
7
4
4
7
5
2
8
3
1
8
3
9
8
4
1
8
4
7
8
7
7
8
8
3
9
4
0
9
4
2
9
4
7
9
4
8
9
5
2
9
5
3
9
9
9
1
0
0
2
1
0
3
4
Golden Promise |L01R01| L|a_1...............TTgtGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Golden Promise |L01R01| R|a_1GTTGGTTCGACAAAGTTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCC
HS92 |L01R01| R|a_1gg*gGTTCGAcaAAgTTctGCGgaAAAtagGAatgGgCtATCCTTcATATAT*gTAGGAAcAg
HS92 |L01R01| L|a_1...............TTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAACATCAACACAGACATGG
Lina |L01R01| L|a_1................TGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Lina |L01R01| R|a_1GTTGGTTCGACAAAGTTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCc
Morex |L01R01| L|a_1...............TTGTGCGGGGAATAgtAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Morex |L01R01| R|a_1GTTGGTTCGACAAAGTTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCT
OWB D |L01R01| R|a_1CACGACAATGGGGGAGAACACAAACGGGTACGTCAACTCGCTTCAAGCTAGCAGACCATGTc
OWB D |L01R01| L|a_1................AACAcAAACGGGTACGTCAACTCGCTTCAAGCTAGCAGACCATGTCCTTGTTAGACTGCAA
Optic |L01R01| L|a_1...............tTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Optic |L01R01| R|a_1GTTGGTTCGAgAAAGTTGTGCGGgAAATAGTAATGGGCTATCCTTcATATATT*TAGGAgCCT
OWB R |L01R01| R|a_1GTTGGTTCGACAAAGTTGTGCGtgGAATAGTAATGGGCTATCCTTcaTATATTGTagcaGccg
OWB R |L01R01| L|a_1................TGtGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Steptoe |L01R01| L|a_1................TGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCTCAACACAGACATGG
Steptoe |L01R01| R|a_1GTTG*TTCGAGAAAGTTGTGCGGGGAATAGTAATGGGCTATCCTTCATATATTGTAGGAGCCT