Polymorphisms for ABC01834

Schematic of mutation locations within contig assembly 'ABC01834_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 4
1
7
4
2
0
4
2
6
4
2
7
4
3
1
4
3
2
4
3
3
4
3
6
4
3
7
4
4
0
4
4
3
4
4
4
4
4
6
4
4
9
4
5
0
4
5
2
4
5
3
4
5
4
4
5
5
4
5
6
4
5
7
4
5
8
4
6
0
4
6
1
4
6
3
4
6
4
4
6
6
4
6
7
4
7
5
4
7
9
4
8
0
4
8
1
4
8
2
4
8
5
4
9
0
4
9
9
5
1
0
5
2
2
5
3
5
6
7
1
7
1
2
Golden Promise |L01R01| R|a_1tgatttgccctttttttccctcttgtctttgtgcaactgcc
Golden Promise |L01R01| L|a_1gttttcccctggaccaggaggaccctcgaaaagcgctatAT
Morex |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTACAACCGGAAATCTTCT
Morex |L01R01| L|a_1AACCCGTCTATAGTTTTAGAGGTTACAACCGGAAATCTTCg
OWB D |L01R01| R|a_1ACGTGACTCGGTCCCCCGTTCCACGTCCTGTCTTGCTTCAC
OWB D |L01R01| L|a_1ACGTGACTCGGTCCCCCGTTCCACGTCCTGTCTTGCTTCAC
Optic |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTg
Optic |L01R01| L|a_1tggggacgtccttgacatgactcgccctaagtccgtcac*T
OWB R |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTA
OWB R |L01R01| L|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTA
Steptoe |L01R01| R|a_1nnCCCGTcnAtcgctctacagggtATAATGTGAaGCCCcgg