Polymorphisms for ABC02329

Schematic of mutation locations within contig assembly 'ABC02329_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 3
0
4
7
6
5
7
3
8
1
1
7
0
2
0
9
2
6
0
2
6
2
2
7
2
2
8
1
2
9
6
3
0
2
3
0
8
3
1
4
3
2
9
3
4
6
3
6
2
3
7
7
4
0
1
Golden Promise |L01R01| R|a_1.tTTTAAGAGTATgGCTCTG
Golden Promise |L01R01| L|a_1GTTTTAAGAGTATGGCTCTg
Morex |L01R01| L|a_1TATTCGGGAATATGGCTCg
Morex |L01R01| R|a_1taTTCGGGAATATGGCTCTG
OWB D |L01R01| R|a_1aAGCCGGTCACGCAATGTGA
OWB D |L01R01| L|a_1TAGCCGGTCAtgCACTGtG
Optic |L01R01| L|a_1GTTTTAAGAGTATGGCTCTG
Optic |L01R01| R|a_1aTTTTAAGAGTATGGCTCTG
OWB R |L01R01| R|a_1gTTTTAAGAGTATGGCTCTG
OWB R |L01R01| L|a_1GTTTTAAGAGTATGGCTCT