Polymorphisms for ABC03343

Schematic of mutation locations within contig assembly 'ABC03343_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 3
5
8
3
8
6
4
1
3
4
4
1
4
4
2
4
7
1
4
7
9
4
8
6
4
9
0
5
4
1
5
9
3
6
4
5
6
9
5
7
2
7
7
9
9
8
1
2
8
8
2
9
2
2
9
3
7
9
5
1
1
0
4
2
1
0
4
6
1
0
5
6
1
1
1
6
Golden Promise |L01R01| L|a_1AATACGTCACGTCACCTAAC
Golden Promise |L01R01| R|a_1.ATACGTCACGTCACCTAACGTAA
HS92 |L01R01| L|a_1AATACGCCACGTCACcTAaC
HS92 |L01R01| R|a_1.ATACGCCACGTCACCTAACGTAA
Lina |L01R01| R|a_1.ATACGTCACGTCACCTAACGTAA
Lina |L01R01| L|a_1AATACGTCACGTCACCTAaC
Morex |L01R01| R|a_1.GCGCACTACTGTGCCcAAC*taA
Morex |L01R01| L|a_1AGCGCACTACTGTG
OWB D |L01R01| R|a_1.GCGTACTGTTGTGGTCCGTATTG
OWB D |L01R01| L|a_1GGCGTACTGTTGTGGTCCG
Optic |L01R01| R|a_1.ATACGTCACGTCACCTAACGTAA
Optic |L01R01| L|a_1AATACGTCACGTCACCTAaC
OWB R |L01R01| L|a_1aATACGTCACGTCACCTAaC
OWB R |L01R01| R|a_1.ATACGTCACGTCACCTAACggaa
Steptoe |L01R01| L|a_1AATACGCCACGTCACCTAa