Polymorphisms for ABC04135

Schematic of mutation locations within contig assembly 'ABC04135_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 5
5
6
7
2
0
2
2
3
5
2
5
0
3
3
1
3
9
7
4
2
4
4
4
5
4
4
6
4
6
3
4
6
6
4
6
7
5
2
7
5
4
0
6
0
0
6
0
1
6
0
2
6
0
4
6
2
8
6
5
1
6
5
7
6
6
7
6
7
4
6
7
5
6
7
9
Golden Promise |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Golden Promise |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG
HS92 |L01R01| L|a_1TCGCTTCGCGACGACGTCTGGTCTGG
Lina |L01R01| R|a_1CGACTCTCC****GCGCTGCGGTTGT
Lina |L01R01| L|a_1CGACTCTCC****GCGCTGCGGT*gT
Morex |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Morex |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG
OWB D |L01R01| L|a_1TCGCTCTCCGAATGTGCTGCGGTTGT
OWB D |L01R01| R|a_1TCGCTCTCCGAATGTGCTGCGGTTGT
Optic |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
OWB R |L01R01| L|a_1TCGCTTCGCGACGACGTCTGGTCTGG
OWB R |L01R01| R|a_1TCGCTTCGCGACGACGTCTGGTCTGG
Steptoe |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Steptoe |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG