Polymorphisms for ABC04320

Schematic of mutation locations within contig assembly 'ABC04320_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 2
9
5
3
0
5
3
1
0
3
2
2
3
2
3
3
2
5
3
2
6
3
2
8
3
3
1
3
3
2
3
3
7
3
4
4
3
5
8
3
6
1
3
7
6
3
7
9
3
8
8
3
9
5
4
0
3
4
0
4
4
1
0
4
1
6
4
2
4
4
2
6
4
3
3
4
5
4
4
5
5
4
7
8
4
9
3
4
9
9
5
1
1
5
2
1
5
4
3
5
4
8
5
5
1
5
7
3
Golden Promise |L01R01| L|a_1GGAGTCTGGGGGgcGcgGcCAGctCCACccCGcgct
HS92 |L01R01| R|a_1GtGGGCGggtAGgCtGggGAggccCCACCcgGtgcg
HS92 |L01R01| L|a_1GGGGGCGAGGCGGCGGGTGAGGCCCCACCCGGTGCG
Lina |L01R01| L|a_1GAGCGCGGGACTACGAATGAGGCTCAGCAGCGCAAA
Morex |L01R01| R|a_1GGAGTCTGGGCGGGGGGGCGAGCTCCACCGCGCGCG
Morex |L01R01| L|a_1GGAGTCTGGGCGGGGGGGCGAGCTCCACCGCGCGCG
Optic |L01R01| R|a_1GAGCGCGGGACTACGAATGAGGCTCAGCAgCGCAAA
OWB R |L01R01| L|a_1TGGCGCGGGACTGGGGGTCAAGCTGCACCCCGCGAG
Steptoe |L01R01| L|a_1GGACgtGAAGAGAAAGGTCAGATTCCATCGGTCGCG
Steptoe |L01R01| R|a_1GGActtGAAGAGAAAGGTCAGATTCCATCGGTCGCG