Polymorphisms for ABC05128

Schematic of mutation locations within contig assembly 'ABC05128_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 3
1
4
6
5
5
6
0
6
1
7
1
7
4
1
0
5
1
0
8
1
2
4
1
4
9
1
7
8
2
0
8
2
1
5
2
2
8
2
2
9
2
5
3
3
2
1
3
3
3
3
6
3
3
9
3
4
0
3
4
0
4
4
1
8
4
2
2
4
3
4
4
3
5
4
5
0
4
5
9
4
6
0
4
7
6
5
0
2
5
1
9
5
5
1
5
7
5
5
9
6
6
0
4
6
0
6
6
3
7
6
9
3
7
1
3
7
2
3
7
3
9
Golden Promise |L01R01| R|a_1ACCGCGAAGCTTCCCCGAATGCTAAGTGCACCAGACGCACTAT
Golden Promise |L01R01| L|a_1ACCGCGAAGCTTCCCCGAATGCTAAGTGCACCAGACGCACTAT
HS92 |L01R01| L|a_1tTATTTAAGTTAAAAGTTTCTCTCCAACTTTATGTAATCACCA
HS92 |L01R01| R|a_1caaacgagtagtcgggatacTggtaACGTGTTCgCCTGACTGT
Morex |L01R01| L|a_1ATTTTAGCATTCGTGCCGGCTTGTAACATGTTCGCCTGATTGT
Morex |L01R01| R|a_1CTTTTAGCATTCGTGCCGGCTTGTAACATGTTCGCCTGATTGT
OWB D |L01R01| R|a_1cTTTTAGCATTCGTGCCGACTCGTAACATGTTCACTTGACTGT
OWB D |L01R01| L|a_1ATTTTAGCATTCGTGCCGACTCGTAACATGTTCACTTGACTGT
Optic |L01R01| L|a_1ACCGCGAAGCTTCCCCGAATGCTAAGTGCACCAGACGCACTAT
Optic |L01R01| R|a_1ACCGCGAAGCTTCCCCGAATGCTAAGTGCACCAGACGCACTAT
OWB R |L01R01| L|a_1ATTTTAGCATTCGTGCCGACTCGTAACATGTTCACTTGACTGT
OWB R |L01R01| R|a_1CTTTTAGCATTCGTGCCGACTCGTAACATGTTCACTTGACTGT
Steptoe |L01R01| L|a_1ATTTTAGCATTCGTGCCGACTCGAAACGTGTTCACTTGGCCGA
Steptoe |L01R01| R|a_1cTTTTAGCATTCGTGCCGACTCGAAACGTGTTCACTTGGCCGA